Naik et al.

Table 1. Primer sequences for polymerase chain reaction

Amplicon

Target Virulence Gene

Primer Sequence (5’-3’

Reference

Size (bp)

(F*): TTGTGTCGCTATCACTGGCAACC

S tn

617

(R**): ATTCGTAACCCGCTCTCGTCC

Murugkar et al. (2003)

(F*): TGTTTCCGGGCTTGTGCT

P ef

700

(R**): CAGGGCATTTGCTGATTCTTCC

* Forward Primer, ** Reverse Primer

and plasmid encoded fimbriae ( pef ) genes of Salmonella in

prepared by boiling and snap chill method (Nagappa et

isolates recovered from chevon and chicken meat samples

al. 2007). Briefly, all Salmonella isolates were grown

collected from different districts of Chhattisgarh.

in 10 ml Luria Bertani (LB) broth (HiMedia, India) and

incubated at 37°C for 24 hrs. Thereafter, one ml of the test

MATERIALS AND METHODS

culture were taken in a 1.5 ml microcentrifuge tube and

centrifuged at 8000 rpm for 10 min. The pellet was washed

Bacterial isolation

twice with sterile saline solution and finally re-suspended

in 300 μl sterilized DNAse and RNAse-free milliQ

During the study period from September 2013 to August

water (Millipore, USA). All the Salmonella isolates were

2014, a total of 32 Salmonella isolates were recovered from

vortexed and boiled for 10 min and then were immediately

chevon and chicken meat samples collected from different

kept on ice. Suspensions were centrifuged at 12000 rpm

districts of Chhattisgarh. Among the 32 salmonella

for 10 min and 3µl of the supernatant was used as a DNA

isolates, 18 and 14 isolates were recovered from chevon

template in PCR mixtures. The PCR analysis for stn and

and chicken meat samples, respectively. All the isolates

pef genes was carried out as per the protocol described

were available and maintained with the Department of

by Murugkar et al. (2003) with suitable modifications.

Veterinary Public health and Epidemiology, College of

The primers sets of stn and pef genes used in this study

Veterinary Science and A.H., Anjora, Durg (C.G.).

were synthesized from Imperial Life Sciences (P) Limited,

Gurgaon, Haryana, India. The primer sequence of target

Polymerase Chain Reaction (PCR) for stn and pef

virulence genes used in this study are presented in Table

genes

1 and PCR cycling conditions are mentioned in Table 2.

All the Salmonella isolates were tested for the presence of

ThePCRwasperformedusingthermocycler(Mastercycler,

virulence associated stn and pef genes using PCR protocols

Eppendorf, Germany) in a final reaction volume of 25 µl

standardized separately for each gene. Template DNA of

containing 2.5 μl of 10X Taq Buffer, 1.5 mM MgCl ₂ , 50

Salmonella isolates incorporated in PCR reactions was

μM of each deoxyribonucleotide triphosphate (dNTP), 10

Table 2. Polymerase chain reaction conditions

Cycling Conditions

Primers

Initial Denaturation

Final Extension

Denaturation

Annealing

Extension

Stn (F*)

94°C for 1min

59°C for 1 min

72°C for 1 min

94°C for 5 min

72°C for 10 min

Stn (R**)

Repeated for 30 Cycles

pef (F*)

94°C for 1min

55°C for 1 min

72°C for 1 min

94°C for 5 min

72°C for 10 min

pef (R**)

Repeated for 25 Cycles

* Forward Primer, ** Reverse Primer

116

Journal of Animal Research: v.5 n.1. April 2015