Fresh leaves of Acacia catechu were procured from Tropical Forest Research Institute campus, Jabalpur, M.P. Mature healthy plant leaves were collected. Eighteen leaves samples were taken and separated for further isolation of endophytic bacteria. Samples were immediately brought to laboratory and were used within 24 hrs and finally processed for isolation of endophytic bacteria. The leaves were surface sterilized with 0.1% sodium hypochlorite for 5 minutes, 0.01% Bavistin, 0.05% streptomycin, 70% ethanol, followed by five times rinses in double distilled water for 5 minutes. Leaves were dried in laminar flow (Mahajan et al., 2014).

To confirm that the surface of leaves were effectively sterilized, 1 ml of the sterile distilled water that was used in final rinse of surface sterilization procedures were plated on to nutrient agar media and incubated at 37°C for 24 hrs. Bacterial growths were observed after 24 hrs.

King’s B (KB) media (HiMedia, India), Mueller Hinton media (HiMedia, INdia), Blood agar media (HiMedia, India) and BHI broth (HiMedia, INdia) were prepared by adding agar into the distilled water. Hot plate was used for the proper mixing of media and autoclaved at 121°C for 15-20 minutes at 15 lbs.

The media were poured into different autoclaved Petri plates and leaves of the plants were embedded in Petri plates. These plates were then incubated at 37°C for 24 hrs. Characterization of the bacteria was done according to its morphology and by Gram’s staining. After that a single colony was transferred into BHI broth and incubated at 37°C for 24 hours.

For purification of endophytic bacteria, subculturing was mainly done by streaking a loop full of BHI broth on the fresh pre solidified blood agar plates and then incubated at 37°C for 24 hrs. After incubation the colony was transferred into BHI broth and then incubated at 37°C for 24 hrs and purity was checked by Gram’s staining and stored for further work.

The characterization was done on the basis of staining, morphological, biochemical and molecular methods.

Gram’s staining was done where thin smears of obtained cultures were prepared on separate glass slides, air dried and heat fixed. Each smear was covered with crystal violet and allowed to stand for 1 minute followed by washing with distilled water. Further Gram’s iodine was added and allowed to stand for 1 minute. Decolourized with 95% ethyl alcohol and the slide was rinsed with distilled water. Slide was flooded with safranin to counterstain and allowed to stand for 1 minute. Smear was rinsed with distilled water and dried with absorbent paper. Slides were then observed at 100X.

Form, elevation, margin, surface, opacity and chromogenesis of isolated endophytic bacterial colonies were noted for morphological characterization.

Various biochemical tests like catalase (Slide method), coagulase (Tube method), Voges-Proskauer, ONPG, urease, arginine utilization and sugar fermentation tests (Hi media Identification test kit) were performed.

DNA isolation – An overnight grown isolated endophytic bacterial colony were picked and resuspended it in 1 ml of autoclaved water in a microfuge tube. Later centrifuged for one minute at 10,000-12,000 rpm. Supernatant was removed and 200 µl of Instagene matrix was added to the pellet and incubated at 56°C for 15-30 minutes. Centrifuged pellet was vortexed for 10 seconds and then tube was placed in a 100°C boiling water bath for 8 minutes. Vortexed at high speed for 10 seconds. Spinned at 10,000-12,000 rpm for 2-3 minutes. Finally isolated DNA was stored at -20°C till further use.

To perform molecular identification of bacteria, marker gene for 16S rRNA was used. The PCR used universal primers 8F (5′AGAGTTTGATCCTGGCTCAG3′) and 1541R (5′AAGGAGGTGATCCAGCCGCA3′) to amplify approximately 1500 bp of 16S rRNA gene (Edward et al., 1989).

Readymix Taq Master mix with MgCl₂ (Himedia) was used to prepare PCR reaction mixture. In a PCR TUBE, 25 µl reaction mixture was prepared as follows:

Mixed gently and briefly centrifuged to collect all components to the bottom of the tube. The PCR tubes with all the components were then transferred to thermal cycler (Bio-Rad laboratories Inc. USA). The PCR protocol designed for 25 cycles is as follows and was kept same for all the primers used.

Initial denaturation step at 95°C for 2 min., 25 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, followed by final extension step at 72°C for 10 min.

The PCR products were tested for amplification of specific gene by agarose gel electrophoresis using 2.0 per cent agarose gel in 1x Tris Borate EDTA Buffer (Sigma-Aldrich, U.S.A.). A total volume of 35 ml of 2.0 per cent agarose (Sigma-Aldrich, U.S.A.) was prepared in 1x Tris Borate EDTA Buffer and placed in microwave oven until melted. Molten agarose was allowed to cool to about 55°C and ethidium bromide was added to give a final concentration of 0.5µg/ml. The gel was poured on to electrophoresis trough fitted with comb. The gel was allowed to set on a flat surface for about 15 minutes. Electrophoresis trough was placed in an electrophoresis tank filled with 1x Tris Borate EDTA Buffer. Samples were prepared on a parafilm by mixing 1 µl of Gel Loading Buffer (Sigma- Aldrich, U.S.A.) and 5 µl of PCR products. Prepared samples were then loaded in parallel with 100 bp ladder (Direct load PCR 100 bp low ladder, Sigma- Aldrich, U.S.A.). Electrophoresis was done at 70 volts for 10 minutes, then at 50 volts for 2 hour. Gel was viewed under a UV Trans-illuminator and photographed with gel documentation system (BIO RAD Gel Doc EZ Images) for future analysis. PCR products were purified using Montage PCR clean up kit (Millipore).

Data sequencing was done at Triyat Genomics, Nagpur, Maharashtra. Sequencing results were compared with existing sequences using Basic Local Alignment Search Tool program on National Centre for Biotechnology Information site (www.ncbi.nlm.nih.gov) to obtain the homology. The program MUSCLE 3.7 was used for multiple alignments of sequences. Finally, the program PhyML 3.0 aLRT was used for phylogeny analysis and HKY85 as substitution model.

In vitro antibacterial activity of endophytic bacteria isolated from Acacia nilotica were studied. Various known pathogenic bacterial cultures viz. Escherichia coli (ATCC 25922), Klebsiella pneumoniae (ATCC 700603), Salmonella Typhimurium (ATCC 13311), Bacillus cereus (ATCC 11778), Staphylococcus aureus (ATCC 6538) and Streptococcus pyogenes (ATCC 12386) were procured from Hi media. Mc-Farlands Nephelometer was used for the determination of concentration of known culture as described by Henric et al. (1956). 1 ml of known culture containing 3.0 × 10⁹ cfu/ml as determined by McFarlands Nephelometer was used for antibacterial activity of endophytic bacteria. For determination of antibacterial activity of endophytic bacteria, broths were centrifuged at 4°C at 12000 rpm for 30 minutes. Supernatant of each of these broths were taken, sterile disc were soaked in these broths in a sterile test tubes for 24 hrs and dried in laminar flow. After drying the discs were used immediately for disc impregnation in the inoculated plates as described by Kirubaharan et al. (1999) with slight modifications. Ciprofloxacin discs were used as control drug to compare the effect of treatment during in vitro study. The prepared bacterial inoculums were evenly spread on a sterile Mueller Hinton agar plate as per method described by Bauer et al. (1969). The known antibiotic Ciprofloxacin (Ci) disc was simultaneously placed as a control for antibiotic sensitivity. The dried disc was incubated at 37°C for 24 hrs. Results were recorded as positive (growth) or negative (no growth) and zone of inhibition of growth exerted by these impregnated discs.

A total 18 isolates of endophytic bacteria were obtained and were characterized using gram’s staining (Fig. 1).

Endophytic bacteria isolated from leaves of Acacia catechu showed that 100 per cent isolates were gram positive and were found to be rods (Fig. 2).

Growth characteristics of endophytic bacteria isolated from Acacia catechu from T.F.R.I campus showed that 84 per cent were irregular in shape while 16 per cent circular in shape, 89 per cent were flat elevation on petriplate while 11 per cent were raised elevation, margin of 67 per cent colonies were entire while 33 per cent were undulated, the surface of the growth was smooth for the entire colonies and 96 per cent growth were opaque and white in colour (Table 1).

The endophytic bacteria isolated from Acacia catechu had shown positive reaction to catalase and sugar fermentation test (maltose) and negative reaction to coagulase, VP, ONPG, urease and arginine utilization tests. The phenetic characterization and biochemical profiling indicated the presence of endophytic bacteria in the leaves of Acacia catechu.

Endophytic bacteria were identified by comparing 16S rRNA gene sequences obtained from bacterial isolates and those deposited in (NCBI) GenBank database using BLAST tool to obtain the sequences that displayed maximum similarity. Results of this analysis showed that one given sequence was actually similar to those sequences of more than one species. The amplified PCR products were run on agarose gel electrophoresis using 2.0 per cent agarose gel in 1x Tris Borate EDTA Buffer, where the fragments with 1500 bp were observed (Fig. 3). Based on 16S rRNA sequence analysis, endophytic bacteria isolated from Acacia catechu were identified as Bacillus humi. Krishnan et al. (2012) had isolated endophytic bacteria from different papaya varieties and 16S rRNA sequence revealed that Bacillus species were the predominant bacterial endophytes (Fig. 4). The result in the study indicates that distribution of endophytic bacteria mainly depends on environmental conditions such as temperature, humidity, UV irradiation and nutrients in the apoplast and not only on host (Sun et al., 2013). The higher frequency of Bacillus species in Acacia catechu leaves may indicate that they have formed a beneficial association with the plant.

The endophytic bacteria isolated from Acacia catechu shown antibacterial activity as 80 per cent isolates inhibited growth of Staphylococcus aureus (Fig. 5), 85 per cent of isolates inhibited growth of Salmonella Typhimurium (Fig. 6) and 60 per cent of isolates inhibited growth of Klebsiella pneumoniae (Fig. 7) and no isolates had inhibited growth of Streptococcus pyogenes, Bacillus cereus and Escherichia coli (Fig. 5).

This antibacterial effect which I have seen in my experimentation may be due to presence of metabolites which suggests that these metabolites of endophytic bacteria might had diffused in the culture medium and suppressed the growth of pathogenic bacteria. The findings of my studies are very similar with the reports of following researchers viz. Roy and Banerjee (2010) had isolated endophytic bacteria from Vinca rosea and one of the isolated endophytes produced potential antimicrobial activity against some selected pathogenic bacteria like Bacillus cereus, Klebsiella pneumoniae, Vibrio cholera, Escherichia coli. Sunkar and Nachiyar (2013) had found antibacterial activity of endophytic bacteria isolated from Brassica oleracea and the isolated endophyte was showing significant antimicrobial activity against Klebsiella pneumoniae NCIM 2883 (20 mm), Staphylococcus aureus ATCC 25923 (25 mm), Escherichia coli ATCC 25922 (13 mm) and Salmonella typhi ATCC 6539 (12 mm).