Ponsubrya et al.

were designed using the Primer 3 algorithm and

1.9 and hence can be effectively used for PCR

were analyzed by BLAST N (Altschul et al ., 1997) to

amplification.

find the homology of the primers. Oligonucleotide

In this study, the sequences of the forward

properties were calculated using the program

and reverse primers designed based on the

Oligocalc (www. Basic.northwestern.edu/biotools/

coat protein gene sequences of Banana bunchy

oligocalc.html) for its performance. The DNA oligos

top virus using the Primer 3 Algorithm are

were synthesized by Sigma Aldrich (USA).

5’ATGGCTAGGTATCCGAAGAAATCC

and

DNA Extraction And PCR Amplification

5 ’ A C T C C A G A A C TA C A ATA G A AT G C C

respectively. The oligonucleotide calculation

Leaf samples were collected from the healthy and

program used for the analyses of the primers showed

symptomatically BBTV infected plants (infection

no hairpin loop formation, no 3’ complementarity

confirmed by ELISA) from the cultivars viz., Red

and no self annealing, indicating good quality

banana (AAA), Palayankodan (AAB), Dwarf

(Chuang et al ., 2013). On PCR amplification using the

Cavendish (AAA), Motta Poovan (AAB) and Ney

designed primers an amplicon of the size approx. 500

Poovan (AB).

bp was obtained in all the infected samples (Plate).

Total genomic DNA was isolated using the protocol

Reproducibility of the reaction was also confirmed.

developed by Doyle and Doyle (1990). The quality of

Transmisssion through infected planting material

the DNA isolated was checked by taking the readings

is a major cause of spread of banana bunchy top

at 260 and 280 nm in UV-Vis spectrophotometer

virus (Harding et al ., 2000; Galal et al ., 2007). PCR

(BioRad, USA).

is an efficient method for BBTV detection and

The polymerase chain reaction was performed with

hence can be used as a reliable detection procedure

20 ng of genomic DNA as template, 0.75U of Taq

for the production of virus free planting material

DNA polymerase (Bangalore Genie), 1X PCR buffer,

(Chandrashekar et al ., 2011). Primer designing is

100 μM of dNTPs and 200 pM each of forward and

most important for the successful detection of the

reverse primer in a final volume of 25 μl in thermal

virus using PCR (Abd-Elsalam, 2003). Differences in

cycler (BioRad). The PCR cycles started with an initial

the coat protein gene sequences have been reported

denaturation step at 94°C for 2 min, followed by 30

in the virus isolates from different regions (Selvarajan

cycles of denaturation at 94 °C for 45 sec, annealing

et al ., 2010). So it is important to develop primers

at 40 °C for 30 sec and extension at 72 °C for 1 min.

specific to each region specific isolate to make the

The reaction was terminated by a final extension step

detection procedure more accurate. Earlier reports

at 72 °C for 5 min.

indicate PCR Detection of Banana Bunchy Top Virus

(BBTV) at tissue culture level in Musa spp . cultivars

PCR amplified products were subjected to

‘Virupakshi’ and ‘Sirumalai’ (AAB) from Tamil

electrophoresis in a 2 % agarose gel in 1X TBE buffer

Nadu (Mahadev et al ., 2013). However, there are no

at 100 volts for 2.5 h. A 1kb DNA marker was also

reports on PCR primers designed for coat protein

loaded. The ethidium bromide stained gels were

from banana cultivars of Kerala. In this context, the

documented using Gel Documentation system

primers designed against the coat protein gene in

(BioRad, USA).

the present study can be used for the early detection

of BBTV using PCR in banana cultivars of Kerala

Results and Discussion

enabling the production of virus free plantlets by

PCR amplification depends on quality of the isolated

micropropagation. The amplified fragments can

DNA (Das et al ., 2009). In the present study the

be sequenced and used for designing of multiplex

protocol of Doyle and Doyle (1990) yielded good

primers for easier detection of viral infection.

quality DNA with A260/280 ranging from 1.7 to

766